circad | circRNAs associated with diseases

CircRNA circ_0000190
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Multiple Myeloma	ICD-10	Multiple myeloma (C90.0)
DBLink	Link to database	PMID	30728056
Experimental Method
Sample Type	Peripheral blood samples	Comparison	All bone marrow tissues and peripheral blood specimens were obtained from patients pathologically and clinically diagnosed as MM or normal people (volunteers)
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GGTTTCCACTTGCTCTGCTT Reverse CAGTGCAATGACATGAGCAGTA	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Feng, Y, Zhang, L, Wu, J, Khadka, B, Fang, Z, Gu, J, Tang, B, Xiao, R, Pan, G, Liu, J (2019). CircRNA circ_0000190 inhibits the progression of multiple myeloma through modulating miR-767-5p/MAPK4 pathway. J. Exp. Clin. Cancer Res., 38, 1:54.